fluorescent protein e2 crimson (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
93
Structured Review
TaKaRa
fluorescent protein e2 crimson
Fluorescent Protein E2 Crimson, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fluorescent+protein+e2+crimson/pCMV-E2-Crimson+Vector/pmc04855666-112-10-16
Average 93 stars, based on 30 article reviews
Fluorescent Protein E2 Crimson, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fluorescent+protein+e2+crimson/pCMV-E2-Crimson+Vector/pmc04855666-112-10-16
Average 93 stars, based on 30 article reviews
fluorescent protein e2 crimson - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Construct:Article Title: Overexpression of human kynurenine-3-monooxygenase protects against 3-hydroxykynurenine-mediated apoptosis through bidirectional nonlinear feedback Article Snippet: The fusion construct gene 10His-E2-Crimson-KMO was synthesised by Genscript and provided in vector pUC57. .. This construct incorporated a 10 × polyhistidine tag (CATCATCATCACCATCATCATCATCATCAC), far-red Sequencing:Article Title: Overexpression of human kynurenine-3-monooxygenase protects against 3-hydroxykynurenine-mediated apoptosis through bidirectional nonlinear feedback Article Snippet: The fusion construct gene 10His-E2-Crimson-KMO was synthesised by Genscript and provided in vector pUC57. .. This construct incorporated a 10 × polyhistidine tag (CATCATCATCACCATCATCATCATCATCAC), far-red Article Title: Group 3 innate lymphoid cells continuously require the transcription factor GATA3 after commitment Article Snippet: .. Briefly, the coding region of a Variant Assay:Article Title: Overexpression of human kynurenine-3-monooxygenase protects against 3-hydroxykynurenine-mediated apoptosis through bidirectional nonlinear feedback Article Snippet: The fusion construct gene 10His-E2-Crimson-KMO was synthesised by Genscript and provided in vector pUC57. .. This construct incorporated a 10 × polyhistidine tag (CATCATCATCACCATCATCATCATCATCAC), far-red Amplification:Article Title: Group 3 innate lymphoid cells continuously require the transcription factor GATA3 after commitment Article Snippet: .. Briefly, the coding region of a Polymerase Chain Reaction:Article Title: Group 3 innate lymphoid cells continuously require the transcription factor GATA3 after commitment Article Snippet: .. Briefly, the coding region of a Plasmid Preparation:Article Title: Group 3 innate lymphoid cells continuously require the transcription factor GATA3 after commitment Article Snippet: .. Briefly, the coding region of a BAC Assay:Article Title: Group 3 innate lymphoid cells continuously require the transcription factor GATA3 after commitment Article Snippet: .. Briefly, the coding region of a |